Rimantadine

In addition, for effective sewage treatment COD-to-Ammonical Nitrogen AN ; ratio of 50: 1 is desired Metcalf & Eddy, 2003 ; . From the result, the ratio of COD-to-AN for both IT systems is too low Table 4.2 ; . It indicates that the existing nutrient contents for treating BOD and COD are too limited. Therefore, the high concentrations of BOD and COD in the effluent are expected. Table 4.1: COD: AN Ratio of the Selected IT Systems System JBT 042 JBT 054 COD: AN 7 4 Normally 50. SECTOR: HEALTH - phase VI Subsector: 02-01 TITLE: Annex 01- National Master List of Drugs CODE DESCRIPTION 02-01-03387 02-01-03388 02-01-03389 Nitric Acid for analysis 1 L. Nitric Acid pure. 1 L. Ortho phosphoric Acid.0.5 L. Oxalic Acid for analysis 500gm Perchloric Acid 70% 500ml. P.A.S Periodic Acid Schiff stain ; 500ml. Picric Acid for analysis 500gm. Sulphanilic Acid 100gm. 5-Sulfo salicylic Acid 500gm Sulphuric Acid for analysis 2.5L. Sulphuric Acid concetrated 2.5L. Tartaric Acid for analysis 250gm. Trichloro Acetic Acid 500gm. Uric Acid for analysis Powder 100gm Albumin Bovin Powder 5gm. Aluminium Pot. sulphate for analysis 250gm. Aluminium sulphate pure 500gm. 4-Amino antipyrin 100gm PHENONAZONE ; Ammonia forte solu. 25% 2.5L. Murexide ammonia purpurate ; Ammonium chloride for analysis 500gm. Ammonium Molybdate for analysis 250gm Aluminium Ammonium Sulphate. Ammonium Alum ; 1kg. Ammonium Oxalate for analysis 500gm Ammonium sulphate for analysis 500gm Acid fuchsin stain 100gm. Acetonitrle 550ml ; Barium chloride 1kg. Bees Wax 250gm. Benzen for analysis 1 L. Bismark Brown Powder 250gm. Brilliant cresyl Blue stain 25gm Brilliant cresyl Green stain 10gm Bromophenol blue stain 25gm Bromothymol Blue stain 25gm. Bromo cresol purple indicator Ph 5.2 -6.8 ; chromium trioxide Citric Acid for analysi 250g Brij 35 Non Ionic surfactant ; 500g Diammonium hydrogen ortho phosphate 500gm Dithisone Cadimium chloride for analysis 100gm Canada Balsam Optically pure 250ml. Ceder wood oil for Microscopy 500ml. Celestine Blue stain 10gm. Charchoal Activated pure powder 500gm.
80. Health Care Dimensions: Transcultural Health Care Issues and Conditions. Madeleine Leininger. Philadelphia: F. A. Davis Company, 1976, 206 pp, .50. 81. Life-Style and Demography of Catholic Religious Sisterhoods and health of other religious groups. Con.J. Fecher, Dayton, Ohio: University of Dayton Press, 1975, 137 pp. 82. Manual of Socialpsychologic Assessment. Gloria M. Francis, Barbara A. Munjas. New York: Appleton-Century-Crofts A publishing division of Prentice-Hall. 209 pp, soft cover. 83. Putting the III at Ease. Evelyn Wilde Mayerson. Hagerstown, MD: Harper & Row, 1976, 313 pp, 66 illus., .95. Investigate is a hands-on science centre for children aged 7 to 14 and adults, too. Here, visitors can take a closer look at hundreds of natural history specimens. Questions on the walls and Qcards prompt open-minded and open-ended exploration of the specimens. Measuring tools and magnifying equipment are provided to encourage visitors to make observations, look for relationships and draw their own conclusions. ICT provision includes a database and other structured activities that broaden and deepen study of the objects. Seasonal activities in the live display area, courtyard garden and activity of the month ensure there is always something new to see and do. 38. Ganciclovir intraocular device and patient survival. Arch Ophthalmol 1994; 112: 19-20. Morlet N, Young SH, Coroneo MT. Ganciclovir intraocular device and patient survival. Arch Ophthalmol 1994; 112: 1404. Polis MA, Masur H. Promising new treatments for cytomegalovirus retinitis. JAMA 1995; 273: 1457-9. Engstrom RE Jr, Holland GN. Local therapy for cytomegalovirus retinopathy. J Ophthalmol 1995; 120: 376-85. Irvine AR. Intraocular sustained drug release devices. Arch Ophthalmol 1995; 113: 25-6. Friedberg DN. Treatment of cytomegalovirus retinitis with intraocular sustained-release ganciclovir implant. Arch Ophthalmol 1995; 113: 1354-5. Ferris FL III, Kassoff A, Bresnick GH, Bailey I. New visual acuity charts for clinical research. J Ophthalmol 1982; 94: 91-6. Kaplan EL, Meier P Nonparametric estimation from incomplete ob. servations. J Stat Assoc 1958; 53: 457-81. Cox DR. Regression models and life-tables. J R Stat Soc [B] 1972; 34: 187-220. Therneau TM. Extending the Cox model. Technical report no. 58. Rochester, Minn.: Department of Health Science Research, Mayo Foundation, June 1996. 48. Kuppermann BD, Quiceno JI, Flores-Aguilar M, et al. Intravitreal ganciclovir concentration after intravenous administration in AIDS patients with cytomegalovirus retinitis: implications for therapy. J Infect Dis 1993; 168: 1506-9. Arevalo JF, Gonzalez C, Capparelli EV, et al. Intravitreous and plasma concentrations of ganciclovir and foscarnet after intravenous therapy in patients with AIDS and cytomegalovirus retinitis. J Infect Dis 1995; 172: 951-6. Mar EC, Cheng YC, Huang ES. Effect of 9- 1, 3-dihydroxy-2-propoxymethyl ; guanine on human cytomegalovirus replication in vitro. Antimicrob Agents Chemother 1983; 24: 518-21. Plotkin SA, Drew WL, Felsentein D, Hirsch MS. Sensitivity of clinical isolates of human cytomegalovirus to 9- 1, 3-dihydroxy-2-propoxymethyl ; guanine. J Infect Dis 1985; 152: 833-4. Drew WL, Miner R, Saleh E. Antiviral susceptibility testing of cytomegalovirus: criteria for detecting resistance to antivirals. Clin Diagn Virol 1993; 1: 179-85. Freeman WR, Friedberg DN, Berry C, et al. Risk factors for development of rhegmatogenous retinal detachment in patients with cytomegalovirus retinitis. J Ophthalmol 1993; 116: 713-20. Sandy CJ, Bloom PA, Graham EM, et al. Retinal detachment in AIDSrelated cytomegalovirus retinitis. Eye 1995; 9: 277-81. Freeman WR, Henderly DE, Wan WL, et al. Prevalence, pathophysiology, and treatment of rhegmatogenous retinal detachment in treated cytomegalovirus retinitis. J Ophthalmol 1987; 103: 527-36. Jabs DA, Enger C, Bartlett JG. Cytomegalovirus retinitis and acquired immunodeficiency syndrome. Arch Ophthalmol 1989; 107: 75-80. Gross JG, Bozzette SA, Mathews WC, et al. Longitudinal study of cytomegalovirus retinitis in acquired immune deficiency syndrome. Ophthalmology 1990; 97: 681-6. Jabs DA, Enger C, Haller J, de Bustros S. Retinal detachments in patients with cytomegalovirus retinitis. Arch Ophthalmol 1991; 109: 794-9. Orellana J, Teich SA, Leiberman RM, Restrepo S, Peairs R. Treatment of retinal detachments in patients with the acquired immune deficiency syndrome. Ophthalmology 1991; 98: 939-43. Sidikaro Y, Silver L, Holland GN, Kreiger AE. Rhegmatogenous retinal detachments in patients with AIDS and necrotizing retinal infections. Ophthalmology 1991; 98: 129-35. Drew WL, Ives D, Lalezari JP, et al. Oral ganciclovir as maintenance treatment for cytomegalovirus retinitis in patients with AIDS. N Engl J Med 1995; 333: 615-20. Body. GAG molecules are long, homogeneous, unbranched polysaccharide chains that are formed by repeating disaccharide subunits. Hyaluronate is the most abundant GAG in synovial fluid. It is produced and secreted by synoviocytes. Hyaluronate is also prevalent in the extracellular matrix of articular cartilage, where it is produced by chondrocytes and where it forms the foundation for proteoglycan aggregates. The recurring disaccharide subunit of hyaluronate consists of N-acetylglucosamine and glucuronate. These sugar subunits are joined by glycosidic bonds. These bonds are extremely flexible in solution; therefore, hyaluronate has no defined tertiary structure. The carboxylate group on the glucuronate sugar is negatively charged. Thus, hyaluronate is a polyanion chain. The recurring electronegative charges along the chain repel one another and attract water molecules. Hence, hyaluronate has been likened to a "molecular sponge." These properties account for the viscosity and elasticity of the hyaluronate macromolecule. Pharmacology of Viscosupplementation The notion of supplementing osteoarthritic synovial fluid with exogenous hyaluronate stems from the fact that the molecular weight and concentration of hyaluronate in osteoarthritic synovial fluid are reduced. This phenomenon diminishes the viscosity of osteoarthritic synovial fluid. Appropriate synovial fluid viscosity is believed to be critical for maintaining normal joint lubrication and is also believed to have chondroprotective effects. It is hypothesized that the reduced concentration and decreased molecular weight of hyaluronate in osteoarthritic synovial fluid renders articular cartilage more vulnerable to mechanical and enzymatic injury. The goal of viscosupplementation is to increase the molecular weight and concentration of hyaluronate in arthritic joints so that the intra-articular milieu more closely resembles that of healthy synovial fluid. The mechanism of action by which viscosupplementation alleviates arthritic knee pain is a subject of debate. It has been proposed that exogenous viscoelastic subISAKOS NEWSLETTER WINTER 2003 9 and ritonavir.

Magnification of 100. Three randomly selected fields of 100 cells each per experimental group were counted on the DAPI setting, and the number of nucleoprotein NP ; -positive cells within this group was determined. Data are representative of at least three independent experiments. Hemagglutination inhibition assays. The hemagglutination inhibition assay was employed to evaluate the effects of the peptides on viral adsorption to target cells. Peptides 0 to 30 serial twofold dilutions in PBS were mixed with a standardized HA concentration of influenza virus and incubated for 1 h at 37C, and 50 l of the solution was mixed with an equal volume of a 0.5% chicken red blood cell suspension for 30 min at room temperature. Results are represented as percentages of the virus-alone sample 100% agglutination ; . Flow cytometry. MDCK cells in suspension 2 105 ; were incubated with MEM alone mock ; or FITC-labeled peptide-treated Tk Ont 32 HA units; 3 104 TCID50 ; for 45 min on ice. Following extensive washing, cells were fixed with 4% paraformaldehyde, and binding was determined by flow cytometric analysis on an LSR-II benchtop flow cytometer BD Biosciences, Franklin Labs, NJ ; . Single cell populations of mock-infected cells were gated based upon forward and side scatter characteristics, and 5, 000 events from each experimental group were recorded. Experiments on all samples were performed in quadruplicate. HA binding assay. HA binding assays were performed as previously described with slight modifications 15, 19 ; . Briefly, microtiter wells were coated with increasing concentrations of peptide 0 to 75 and washed with PBS containing 0.1% Tween-20, and nonspecific binding sites were blocked with 2% Fraction V BSA Fisher Scientific ; in PBS0.1% Tween-20. Purified recombinant Hong Kong 1203 HA rHA; Protein Sciences, Meriden, CT ; was added to each well at a concentration of 0.01 g, incubated for 2 h at room temperature, and washed extensively. Peptide-bound rHA was detected by incubation with anti-HAV5 goat serum National Institute of Allergy and Infectious Diseases, Bethesda, MD ; and donkey anti-goat immunoglobulin G 1: 2, 000; Southern Biotech, Birmingham, AL ; , followed by quantification using tetramethylbenzidine R&D Systems ; . Absorbance was measured at 405 nm A405 nm ; with an A605 correction on a SpectraMax 250 Spectraphotometer Molecular Devices ; . Specific binding was determined by calculating the relative change n-fold ; of rHA binding over wells precoated with BSA 2% ; . To test competition, 0.1 g ml rHA was combined with 10 M peptide and added to 10 M EB-coated wells 1: molar competition concentration ; . Data are presented as the mean value standard error of A405 nm A605 nm n 3 ; Animals. Four- to six-week-old BALB c mice Charles River Laboratories, Stoneridge, NY ; were lightly anesthetized by halothane inhalation and intranasally inoculated with 25 l of PBS control ; , untreated HK 156 104 TCID50 ; , or EB-treated 2 mM ; HK 156 virus. To evaluate the therapeutic use of EB, additional groups of infected mice were anesthetized and administered 2 mM EB-D or rimantadine hydrochloride 40 mg kg; Sigma ; 32 ; intranasally 6 hpi, with readministration daily for 5 days. Animals were scored for clinical signs of infection 0, no visible signs of illness; 1, ruffled coat, hunched posture; 2, slowed movement, shivering; 3, labored breathing, anorexia, little to no movement; or 4, paralysis, moribund [23] ; , and individual body weights were recorded for each group 10 mice per group ; on 0 to days postinfection dpi ; . At days 2 and 4 postinfection, two mice from the control group and three mice from each experimental group were euthanized, and the lungs were collected. The tissues were weighed and homogenized in 1 ml cold PBS and stored at 70C until use. Titers were evaluated by serial titration on MDCK cells. The peptides alone exhibited no toxicity in vivo as measured by clinical signs and weight loss data not shown ; . Statistical analysis. All data were determined in triplicate and are representative of at least three separate experiments. The results represent the means standard deviations of triplicate determinations. Statistical significance of the data was determined by using analysis of variance or a Student's t test.
Materials. Sprague-Dawley rats were from Charles River. Media, sera, and other tissue culture reaaents were obtained from GIBCO-Bethesda Research Labs. Drugs were-obtained from Research Biochemicals, Inc. Radiochemicals were from New England Nuclear. Synaptosomalpreparution. Fresh crude synaptosomes were prepared according to the method described by Javitch et al. 1985 ; with minor modifications. Male Sprague-Dawley rats 250-350 gm ; were killed by decaoitation and the brains were chilled for 5 min in ice-cold PBS. The striatum was dissected at 4C from l-mm-thick coronal slices on an ice-chilled glass plate and homogenized in 15 vol gm tissue ml ; of icecold 0.3 M sucrose in a tapered glass tissue grinder with a Teflon pestle clearance of the cvlindrical section. 0.1-O. 15 mm: Wheaton ; . The homogenate was diluted 1: 3 in 0.3 M `sucrose and centrifuged at 1000 x g for 10 min. The supematant was centrifuged at 12, 000 x g for 20 min. The second pellet was resuspended in 30 vol of 0.3 M sucrose and used for uptake experiments. Cell cu&e. CdS-7 African green monkey kidney ; , Ltkm mouse fibroblast ; . CHO Chinese hamster ovary ; . NG 108-5 mouse neuroblastoma"x rat glioma hybrid ; , and NS2bY mouse neuroblastoma ; cells were grown in Dulbecco's modified Eagle's medium with L-glutamine and 4500 mg liter D-glucose; the medium of COS-7 and Ltkm cells also contained 10% heat-inactivated fetal bovine serum and 50 ~Lgl ml aentamicin; that of NG 108- 15 cells, 5% heat-inactivated fetal bovine serum, 0.1 mM sodium hypoxanthine, 16 thymidine, and 1 IM aminonterin. Media for NS20Y cells contained 10% heat-inactivated fetal bovine serum and 110 mg liter sodium pyruvate. SK-N-MC human neuroblastoma ; cells were grown in minimum essential medium with Earle's salts and L-glutamine, 10% heat-inactivated fetal bovine serum, and 50 Me ml gentamicin. All cells were grown in lOO- or 150mm-diameter tissue culture dishes polystyrene, Falcon ; at 37C under an atmosphere of 5% CO 95% air, or in case of NS20Y cells under an atmosphere of 10% CO 90% air. Cell line transfection. The rat and human dopamine transporter cDNAs were used in the exuression vector nCMV5 Giros et al. 1991. 1992 ; for establishing the stable Ltkm cell lines, whereas the human transporter cDNA was subcloned into pRc CMV Invitrogen Corporation ; for transfection of all other cell lines. In order to obtain the human dopa mine transporter in pRc CMV, the cDNA subcloned in pBluescript Giros et al., 1992 ; was amplified by polymerase chain reaction PCR ; as described Giros et al., 1989 ; with two primers flanking the coding region. The primer in 5' contained an Hind III site GTAAAGCTTC AACI'CCCAGTGTGCCCATG ; whereas the primer in 3' contained an Xba I site GCGTCTAGACTTCCTGGGGTCTTCGTCTCTG ; . The amplified DNA was excised with the appropriate restriction enzymes and directionally subcloned into the corresponding sites of pRc CMV. One clone was amplified and sequenced to check that there were no PCR errors. This clone was used for all the following transfections. For transient expression DEAE-dextran transfection was used for COS-7 and NS20Y. cells, and calcium phosphate transfection was used for SK-N-MC and NG108-15 cells: 3 x lo6 cells were inoculated in lOOmm-diameter dishes 1 d COS-7, NG 108- 15 cells ; or 2 d NS20Y, SKN-MC cells ; before the transfection `procedure. The DEAE-dextran transfection was started by washing the cells with PBS; then cells were incubated for 30 min with 5 ml of PBS containing 2.5 mg of DEAEdextran and 15 rg of DNA at 37C in the incubator. Twenty milliliters of medium containing 1.032 mg of chloroquine were then added and the cells incubated for 2.5 hr. After removing the medium, cells were treated for 2.5 min with 5 ml of medium containing 15% dimethyl sulfoxide, and incubated in medium overnight. The next morning cells from two 100-mm-diameter plates were distributed into three 24-well plates for uptake studies, which were carried out 2 d later. The calcium phosphate transfection was done according to the supplier's instruction CellPhect transfection kit. Pharmacia ; . The cells of two lOO-mm-diameter plates were distributed into three 24-well plates on the day after transfection. For stable transfection the calcium phosphate transfection system from Bethesda Research Labs was used; 1 x 1O6cells were plated into lOO-mm-diameter cell culture dishes 1 d Ltk-, CHO ; or 2 d SKN-MC ; before transfection; 15 fig of human or rat dopamine transporter cDNA subcloned into pCMV5, 0.75 pg of pRSVNeo, and 5 PLcg carrier of DNA salmon sperm DNA ; were used per lOO-mm-diameter dish of Ltkm and CHO cells. SK-N-MC cells were transfected either with 15 PLg of rat dopamine transporter cDNA subcloned into pCMV5, 0.75 pg of pRSVNeo, and 5 pg of carrier DNA, or with 15 pg of human dopamine transporter subcloned into pRc CMV and 5 pg of carrier DNA. The and rituxan.

References: 1. Dharmananda, S. 1986 ; . Your nature, your health Chinese herbs in constitutional therapy. Portland, OR.: Institute for Traditional Medicine and Preventive Health Care. 2. Huang, K. C. 1999 ; . The pharmacology of Chinese herbs 2nd ed. ; . Boca Raton, FL: CRC Press. 3. Jellin, J. M., Gregory, P., Batz, F., Hitchens, K., et al. 2000 ; . Natural medicines comprehensive database 3rd ed. ; . Stockton, CA: Therapeutic Research Faculty. Introduction was heralded by a veritable blizzard of seasonal advertising by the manufacturers and the subsequent flurry of media interest in the disease, its prevention, and treatment. Multiple studies demonstrate that NIs, started within 24 to 48 hours of symptom onset, reduce the duration of the illness by 1 to 1.5 days equivalent to the reduction seen with amantadine and rimantadine ; and may decrease the duration of viral shedding.7-9 In contrast to amantadine and rimantadine, these drugs are effective against influenza types A and B, appear to have a limited potential for the development of drug resistance, and are generally well tolerated.10 Although NIs represent an advance in the treatment of influenza, they also are more costly than the older antiviral agents average wholesale price for a 5-day course of treatment: amantadine, .44; rimantadine, .60; zanamivir, .02; oseltamivir, .54 ; .11 Because NIs are effective only against influenza and not other respiratory viruses, prompt and accurate diagnosis of influenza appears to have value for appropriately directing NI treatment to those for whom the treatment can be beneficial ie, individuals with influenza ; . However, influenza testing entails incremental cost, and the accuracy of available tests is not perfect.12 Thus, the challenge for clinicians when deciding on management options for patients presenting with ILI is to understand the clinical and economic tradeoffs involved in diagnostic testing and NI treatment of those patients and rms.

City in 1984. Having already completed an undergraduate degree in Management at Notre Dame and a Masters of Science Degree in Business Administration at Boston University, McDonnell then achieved a Masters Degree in Public Policy and his Law Degree at Regent University. In 1989 McDonnell became a prosecutor in the Virginia Beach Commonwealth Attorney's Office. McDonnell's first attempt at elected office was a formidable task. McDonnell decided to run for the 84th District Seat in the Virginia House of Delegates in 1991 and immediately faced an uphill battle. The battle was in the form of facing a twenty-year Democratic incumbent and overcoming a tightly budgeted campaign. Perhaps McDonnell's ability to overcome obstacles can be attributed to his service in the United States Army. McDonnell served 4 years active duty and another sixteen in the reserves before retiring in 1997 with the rank of Lieutenant Colonel. During his time in the Army, McDonnell served as Medical Services Officer and was responsible for logistical support of medical services. This duty required the ability to coordinate with others, as well as locate and acquire resources to serve a large population. In his new position as Attorney General, McDonnell will again focus on his ability to provide a quality service to a large population. McDonnell would like to see the Attorney General's Office recognized as a leader in state government by providing the best possible representation to its clients. McDonnell would also like to see laws strengthened in the Commonwealth to protect children from those wishing to do them harm in addition to supporting legislation that is family focused. In the service of life and health, Sanofi-Synthlabo has adopted an ambitious program to protect the safety and health of its employees, to guarantee the safety of its industrial sites, and to respect the environment. The Group sees this constant effort to respond to these major challenges as a driving force for internal progress and a key advantage in its relationships with partners and clients and robaxin. Psychostimulant medications are used with precaution in tic spectrum disorders but the CAP-Guidelines Committee agree that their use can be indicated if there is sufficient impairment of the concurrent ADHD. In these cases, the medications for ADHD are often combined with other drugs for tics e.g., atypical neuroleptics or alpha-2-agonists.

Effect on channel deactivation. Additionally, a significant enhancement of slow inactivation was observed in the I1495F mutation. In contrast, the T704M mutation, a hyperkalaemic periodic paralysis mutation located in the cytoplasmic interface of the S5 segment of the second domain, also shifted activation in the hyperpolarizing direction but had little effect on fast inactivation and dramatically impaired slow inactivation. These results, showing that the I1495F and T704M hyperkalaemic periodic paralysis mutations both have profound effects on channel activation and fastslow inactivation, suggest that the S5 segment maybe in a location where fast and slow inactivation converge. Key words: Na channel; SCN4A; disorders; activation; slow inactivation; expression McClatchey et al., 1992 ; , and potassium-aggravated myotonia PAM ; Lerche et al., 1993; Ptacek et al., 1994 ; . All channel domains carry at least one disease-causing mutation, and all transmembrane segments seem to be targeted, except the membrane spanning segments S2 and S5 for review, see Bulman, 1997 ; . Many of these mutations have been overexpressed in Xenopus oocytes or in mammalian heterologous systems. These studies demonstrated the existence of many defects in channel function that may underlie either muscle hyperexcitability or inexcitability, such as the presence of sustained inward current, shift in steady-state inactivation or activation, alteration of channel deactivation, modification of channel recovery from fast inactivation, and impairment of slow inactivation. Five point mutations have been reported to affect the human sodium channel gene SCN4A causing HyperKPP: T704M Cannon and Strittmatter, 1993; Cummins et al., 1993; Yang et al., 1994; Cummins and Sigworth, 1996; Hayward et al., 1997 ; , V781I Baquero et al., 1995 ; , A1156T Yang et al., 1994 ; , M1360V Wagner et al., 1997 ; , and M1592V Hayward et al., 1997 ; . A recent study of the V781I mutation in human embryonic kidney HEK ; 293 cells suggested that this mutation may be a benign polymorphism Green et al., 1997 ; . All of these HyperKPP mutations show a common feature; they are localized at the intracellular membrane interface. HyperKPP-causing mutations have not been found in the extracellular loops or in the middle of any membrane spanning domain to date. We report here a novel missense mutation in the SCN4A in a patient with HyperKPP, causing the amino acid change from isoleucine to phenylalanine and robitussin.
Study design. Both clinical trials were randomized, placebo-controlled, and double-blind in design. The family-based study 13 ; was conducted at three centers Charlottesville, Va.; Huntington, W.V.; Oklahoma City, Okla. ; , whereas the adult treatment study was undertaken in Charlottesville, Va. Both studies were conducted during the winter season of 1988, during which influenza A virus H3N2 subtype ; caused outbreaks. Written informed consent in a form approved by the respective institutional review boards of the participating centers was obtained. Compensation was provided to participants. Family-based study. The methods used for recruitment, surveillance, sampling, and drug administration in the multicenter, family-based trial have been described previously 13 ; . Briefly, when an influenzal illness developed in one or more family members, all eligible family members ages, 1 to 75 years ; , including healthy contacts and those who were ill, were assigned as a block to receive either rimantadine or placebo once daily for 10 days. Rimantadine was administered in tablet or syrup form for children 10 years of age ; . The daily dose was 200 mg for adults and children 10 years and older. The dose was 5 mg kg of body weight up to a.